Review





Similar Products

90
ATCC gcgcgtgtggcgtaattggtagccgcgccagacttaggatctggtgtcgtgagacgtgta ggttcgagtcctatcacgcgcacaa bacteroides vulgatus atcc 8482 chr
Gcgcgtgtggcgtaattggtagccgcgccagacttaggatctggtgtcgtgagacgtgta Ggttcgagtcctatcacgcgcacaa Bacteroides Vulgatus Atcc 8482 Chr, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gcgcgtgtggcgtaattggtagccgcgccagacttaggatctggtgtcgtgagacgtgta ggttcgagtcctatcacgcgcacaa bacteroides vulgatus atcc 8482 chr/product/ATCC
Average 90 stars, based on 1 article reviews
gcgcgtgtggcgtaattggtagccgcgccagacttaggatctggtgtcgtgagacgtgta ggttcgagtcctatcacgcgcacaa bacteroides vulgatus atcc 8482 chr - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc rras2 plasmid
Rras2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rras2 plasmid/product/Addgene inc
Average 90 stars, based on 1 article reviews
rras2 plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc rras2 addgene 38816 vector
Rras2 Addgene 38816 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rras2 addgene 38816 vector/product/Addgene inc
Average 90 stars, based on 1 article reviews
rras2 addgene 38816 vector - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc n a plasmid
N A Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n a plasmid/product/Addgene inc
Average 90 stars, based on 1 article reviews
n a plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results